Transcript: Human NM_001389.5

Homo sapiens DS cell adhesion molecule (DSCAM), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Homo sapiens (human)
Gene:
DSCAM (1826)
Length:
8571
CDS:
498..6536

Additional Resources:

NCBI RefSeq record:
NM_001389.5
NBCI Gene record:
DSCAM (1826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001389.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063992 CCCAGTCTAGTAACGATTGAT pLKO.1 4476 CDS 100% 5.625 7.875 N DSCAM n/a
2 TRCN0000063988 CCGCCTTTCATACAACCCTTT pLKO.1 2283 CDS 100% 4.050 5.670 N DSCAM n/a
3 TRCN0000063990 CCATCCATACTGGATGGGTTT pLKO.1 1170 CDS 100% 0.405 0.324 N DSCAM n/a
4 TRCN0000063991 CCCGAAATTGAGATCAAAGAT pLKO.1 3162 CDS 100% 5.625 3.938 N DSCAM n/a
5 TRCN0000063989 CCTCATACATTTGCCTCCATA pLKO.1 6188 CDS 100% 4.950 3.465 N DSCAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001389.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.