Transcript: Human NM_001430.5

Homo sapiens endothelial PAS domain protein 1 (EPAS1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
EPAS1 (2034)
Length:
5155
CDS:
506..3118

Additional Resources:

NCBI RefSeq record:
NM_001430.5
NBCI Gene record:
EPAS1 (2034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001430.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003806 CAGTACCCAGACGGATTTCAA pLKO.1 2050 CDS 100% 5.625 7.875 N EPAS1 n/a
2 TRCN0000342501 CAGTACCCAGACGGATTTCAA pLKO_005 2050 CDS 100% 5.625 7.875 N EPAS1 n/a
3 TRCN0000003805 GCGCAAATGTACCCAATGATA pLKO.1 2775 CDS 100% 5.625 3.938 N EPAS1 n/a
4 TRCN0000342452 GCGCAAATGTACCCAATGATA pLKO_005 2775 CDS 100% 5.625 3.938 N EPAS1 n/a
5 TRCN0000003803 AGGTGGAGCTAACAGGACATA pLKO.1 873 CDS 100% 4.950 3.465 N EPAS1 n/a
6 TRCN0000003807 CCATGAGGAGATTCGTGAGAA pLKO.1 922 CDS 100% 4.950 3.465 N EPAS1 n/a
7 TRCN0000352630 CCATGAGGAGATTCGTGAGAA pLKO_005 922 CDS 100% 4.950 3.465 N EPAS1 n/a
8 TRCN0000003804 CGACCTGAAGATTGAAGTGAT pLKO.1 1987 CDS 100% 4.950 3.465 N EPAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001430.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.