Transcript: Human NM_001496.4

Homo sapiens GDNF family receptor alpha 3 (GFRA3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GFRA3 (2676)
Length:
1988
CDS:
198..1400

Additional Resources:

NCBI RefSeq record:
NM_001496.4
NBCI Gene record:
GFRA3 (2676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001496.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372302 GGATCACCAGAATCTAATAAG pLKO_005 1690 3UTR 100% 13.200 10.560 N GFRA3 n/a
2 TRCN0000372301 ACAGGAGAAGCTAAGGGTTAT pLKO_005 1513 3UTR 100% 10.800 7.560 N GFRA3 n/a
3 TRCN0000372354 ATTCCTGCACCTCTAGCATAA pLKO_005 391 CDS 100% 10.800 7.560 N GFRA3 n/a
4 TRCN0000378694 CAGATCACGCCTGGTGGATTT pLKO_005 980 CDS 100% 10.800 7.560 N GFRA3 n/a
5 TRCN0000060741 GTTGCCTGCTTGGACATCTAT pLKO.1 528 CDS 100% 5.625 3.938 N GFRA3 n/a
6 TRCN0000060740 GCTGTGTACTCTCAATGACAA pLKO.1 698 CDS 100% 4.950 3.465 N GFRA3 n/a
7 TRCN0000060738 CCATTGCAGCTAAGATGCGTT pLKO.1 1228 CDS 100% 2.640 1.848 N GFRA3 n/a
8 TRCN0000060739 CTTGGTAACTATGAGCTGGAT pLKO.1 573 CDS 100% 2.640 1.848 N GFRA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001496.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.