Transcript: Human NM_001707.4

Homo sapiens BAF chromatin remodeling complex subunit BCL7B (BCL7B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BCL7B (9275)
Length:
1663
CDS:
113..721

Additional Resources:

NCBI RefSeq record:
NM_001707.4
NBCI Gene record:
BCL7B (9275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001707.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033574 CACGTCCCTGAGGATATTTAA pLKO.1 232 CDS 100% 15.000 21.000 N BCL7B n/a
2 TRCN0000299868 CACGTCCCTGAGGATATTTAA pLKO_005 232 CDS 100% 15.000 21.000 N BCL7B n/a
3 TRCN0000303828 TCCTGGCCCTGCCTCTATTTA pLKO_005 742 3UTR 100% 15.000 10.500 N BCL7B n/a
4 TRCN0000033575 CCTAATGGCTTTCCTTCTGAT pLKO.1 320 CDS 100% 4.950 3.465 N BCL7B n/a
5 TRCN0000299792 CCTAATGGCTTTCCTTCTGAT pLKO_005 320 CDS 100% 4.950 3.465 N BCL7B n/a
6 TRCN0000033577 CCTACCCTCACCAAGGAAGAA pLKO.1 587 CDS 100% 4.950 3.465 N BCL7B n/a
7 TRCN0000299865 CCTACCCTCACCAAGGAAGAA pLKO_005 587 CDS 100% 4.950 3.465 N BCL7B n/a
8 TRCN0000193052 CCCTGCCTCTATTTATTGCAT pLKO.1 748 3UTR 100% 3.000 2.100 N Bcl7b n/a
9 TRCN0000033576 CCCAGCACACACCTCCGACTT pLKO.1 478 CDS 100% 0.000 0.000 N BCL7B n/a
10 TRCN0000299791 CCCAGCACACACCTCCGACTT pLKO_005 478 CDS 100% 0.000 0.000 N BCL7B n/a
11 TRCN0000033578 AGTGCGGAAATGGGAGAAGAA pLKO.1 193 CDS 100% 4.950 2.970 N BCL7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001707.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.