Transcript: Human NM_001762.4

Homo sapiens chaperonin containing TCP1 subunit 6A (CCT6A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CCT6A (908)
Length:
2584
CDS:
85..1680

Additional Resources:

NCBI RefSeq record:
NM_001762.4
NBCI Gene record:
CCT6A (908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001762.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062516 GCACACACTCACTCAGATCAA pLKO.1 1227 CDS 100% 4.950 3.960 N CCT6A n/a
2 TRCN0000307686 GCACACACTCACTCAGATCAA pLKO_005 1227 CDS 100% 4.950 3.960 N CCT6A n/a
3 TRCN0000062513 CGCCACAAAGTTGTAGGAAAT pLKO.1 2206 3UTR 100% 10.800 7.560 N CCT6A n/a
4 TRCN0000291370 CGCCACAAAGTTGTAGGAAAT pLKO_005 2206 3UTR 100% 10.800 7.560 N CCT6A n/a
5 TRCN0000062515 CCAGAACATCTCTTCGTACTA pLKO.1 539 CDS 100% 4.950 3.465 N CCT6A n/a
6 TRCN0000291371 CCAGAACATCTCTTCGTACTA pLKO_005 539 CDS 100% 4.950 3.465 N CCT6A n/a
7 TRCN0000062514 CGTGTCATTAGAGTATGAGAA pLKO.1 786 CDS 100% 4.950 3.465 N CCT6A n/a
8 TRCN0000333801 CGTGTCATTAGAGTATGAGAA pLKO_005 786 CDS 100% 4.950 3.465 N CCT6A n/a
9 TRCN0000062517 CCCTGATTAAACATAAGCCCA pLKO.1 1346 CDS 100% 0.660 0.462 N CCT6A n/a
10 TRCN0000120444 CCTTCAGGAAACATTAGTTAA pLKO.1 1458 CDS 100% 13.200 6.600 Y Cct6a n/a
11 TRCN0000320073 CCTTCAGGAAACATTAGTTAA pLKO_005 1458 CDS 100% 13.200 6.600 Y Cct6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001762.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00241 pDONR223 100% 100% 100% None n/a
Download CSV