Transcript: Human NM_001999.4

Homo sapiens fibrillin 2 (FBN2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FBN2 (2201)
Length:
10927
CDS:
643..9381

Additional Resources:

NCBI RefSeq record:
NM_001999.4
NBCI Gene record:
FBN2 (2201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001999.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427245 CCTCACAGGGAGGGATAATTT pLKO_005 9525 3UTR 100% 15.000 21.000 N FBN2 n/a
2 TRCN0000055929 CGTGGTAGTTACCGTTGTAAT pLKO.1 3004 CDS 100% 13.200 18.480 N FBN2 n/a
3 TRCN0000435155 GCAACCGTGGTTACTGTATTT pLKO_005 9580 3UTR 100% 13.200 18.480 N FBN2 n/a
4 TRCN0000433994 GTGAATGCAACATGGGTTATA pLKO_005 2198 CDS 100% 13.200 18.480 N FBN2 n/a
5 TRCN0000055932 CCTGTGTAGATCGCAATGAAT pLKO.1 6308 CDS 100% 5.625 7.875 N FBN2 n/a
6 TRCN0000423078 CACACCTGGTTCCTATTATTG pLKO_005 2295 CDS 100% 13.200 9.240 N FBN2 n/a
7 TRCN0000055928 CGGCACATACACACTGGAAAT pLKO.1 9237 CDS 100% 10.800 7.560 N FBN2 n/a
8 TRCN0000055931 CCCATGATGAATTGTGAAGAT pLKO.1 7381 CDS 100% 4.950 3.465 N FBN2 n/a
9 TRCN0000055930 GCAGCATCATTCCTGGGATAT pLKO.1 1607 CDS 100% 10.800 6.480 N FBN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001999.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.