Transcript: Human NM_002006.5

Homo sapiens fibroblast growth factor 2 (FGF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
FGF2 (2247)
Length:
6781
CDS:
69..935

Additional Resources:

NCBI RefSeq record:
NM_002006.5
NBCI Gene record:
FGF2 (2247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002006.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355839 GAAACGAACTGGGCAGTATAA pLKO_005 848 CDS 100% 13.200 18.480 N FGF2 n/a
2 TRCN0000003332 GTTACGGATGAGTGTTTCTTT pLKO.1 756 CDS 100% 5.625 7.875 N FGF2 n/a
3 TRCN0000003331 CTATCAAAGGAGTGTGTGCTA pLKO.1 685 CDS 100% 2.640 3.696 N FGF2 n/a
4 TRCN0000368438 TATAGCTCAGTTTGGATAATT pLKO_005 1024 3UTR 100% 15.000 10.500 N FGF2 n/a
5 TRCN0000355907 TGAACGATTGGAATCTAATAA pLKO_005 779 CDS 100% 15.000 10.500 N FGF2 n/a
6 TRCN0000355837 GAAGATTACTGGCTTCTAAAT pLKO_005 733 CDS 100% 13.200 9.240 N FGF2 n/a
7 TRCN0000003333 GCAGTCATAAACAGAAGAATA pLKO.1 5919 3UTR 100% 13.200 9.240 N FGF2 n/a
8 TRCN0000067287 GAGAGGAGTTGTGTCTATCAA pLKO.1 671 CDS 100% 5.625 3.938 N Fgf2 n/a
9 TRCN0000003330 GACCCTCACATCAAGCTACAA pLKO.1 636 CDS 100% 4.950 3.465 N FGF2 n/a
10 TRCN0000003329 ACTACAATACTTACCGGTCAA pLKO.1 799 CDS 100% 4.050 2.835 N FGF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002006.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.