Transcript: Human NM_002039.4

Homo sapiens GRB2 associated binding protein 1 (GAB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
GAB1 (2549)
Length:
7774
CDS:
314..2398

Additional Resources:

NCBI RefSeq record:
NM_002039.4
NBCI Gene record:
GAB1 (2549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002039.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418039 AGTTAACACACTCGTAGTATT pLKO_005 2646 3UTR 100% 13.200 18.480 N GAB1 n/a
2 TRCN0000446245 GTTACGCAGTGGCCGTTTAAC pLKO_005 409 CDS 100% 13.200 18.480 N GAB1 n/a
3 TRCN0000074287 GCTGGATTGACATTTAACAAA pLKO.1 521 CDS 100% 5.625 7.875 N GAB1 n/a
4 TRCN0000074285 GCCTTCACGTAGTAATACCAT pLKO.1 1456 CDS 100% 3.000 4.200 N GAB1 n/a
5 TRCN0000074286 GCTATGATATTCCACGAGCAT pLKO.1 1527 CDS 100% 2.640 3.696 N GAB1 n/a
6 TRCN0000425390 CCAATGTACCTTACCATAATT pLKO_005 2713 3UTR 100% 15.000 10.500 N GAB1 n/a
7 TRCN0000074283 GCACCTTTGAAAGACTGAATA pLKO.1 3078 3UTR 100% 13.200 9.240 N GAB1 n/a
8 TRCN0000414176 TAACCTGCCCAGGAGTTATTC pLKO_005 1090 CDS 100% 13.200 9.240 N GAB1 n/a
9 TRCN0000074284 CCTGGTAATACTTATCAGATT pLKO.1 1250 CDS 100% 4.950 3.465 N GAB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002039.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00605 pDONR223 100% 95.8% 95.8% None 1584_1585ins90 n/a
2 ccsbBroad304_00605 pLX_304 0% 95.8% 95.8% V5 1584_1585ins90 n/a
Download CSV