Transcript: Human NM_002092.4

Homo sapiens G-rich RNA sequence binding factor 1 (GRSF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-01
Taxon:
Homo sapiens (human)
Gene:
GRSF1 (2926)
Length:
6610
CDS:
64..1506

Additional Resources:

NCBI RefSeq record:
NM_002092.4
NBCI Gene record:
GRSF1 (2926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002092.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293627 CACGTTCATCATAGGTATATT pLKO_005 1450 CDS 100% 15.000 21.000 N GRSF1 n/a
2 TRCN0000293625 TAATCGATACATCGAGATATT pLKO_005 1008 CDS 100% 13.200 18.480 N GRSF1 n/a
3 TRCN0000075044 CGGTGAGAATGGAATACATTT pLKO.1 594 CDS 100% 13.200 9.240 N GRSF1 n/a
4 TRCN0000286172 CGGTGAGAATGGAATACATTT pLKO_005 594 CDS 100% 13.200 9.240 N GRSF1 n/a
5 TRCN0000293626 TCATTGTAAAGACCACATATT pLKO_005 1818 3UTR 100% 13.200 9.240 N GRSF1 n/a
6 TRCN0000075046 GCCCAAGACATTATAAACTTT pLKO.1 1303 CDS 100% 5.625 3.938 N GRSF1 n/a
7 TRCN0000286111 GCCCAAGACATTATAAACTTT pLKO_005 1303 CDS 100% 5.625 3.938 N GRSF1 n/a
8 TRCN0000075043 CCAAACATTCACCAAAGCAAA pLKO.1 1956 3UTR 100% 4.950 3.465 N GRSF1 n/a
9 TRCN0000075047 TCTCCTAAACAGAGATGGGAA pLKO.1 615 CDS 100% 2.640 1.848 N GRSF1 n/a
10 TRCN0000075045 CGGTTCTTATAAGGGAAAGAA pLKO.1 1062 CDS 100% 0.563 0.394 N GRSF1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5909 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4241 3UTR 100% 4.950 2.475 Y DCAF11 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5909 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002092.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.