Transcript: Human NM_002098.6

Homo sapiens guanylate cyclase activator 1B (GUCA1B), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GUCA1B (2979)
Length:
2270
CDS:
137..739

Additional Resources:

NCBI RefSeq record:
NM_002098.6
NBCI Gene record:
GUCA1B (2979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002098.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412742 CACTCTTTATGCATGAGTTTA pLKO_005 243 CDS 100% 13.200 10.560 N GUCA1B n/a
2 TRCN0000056299 CAGGAGTGGTACAAGAAGTTT pLKO.1 200 CDS 100% 5.625 3.938 N GUCA1B n/a
3 TRCN0000442936 ACCCAGGTTTCCAGGGTAGTA pLKO_005 772 3UTR 100% 4.950 3.465 N GUCA1B n/a
4 TRCN0000056301 CCAGTATGTAGAGGGCATGTT pLKO.1 301 CDS 100% 4.950 3.465 N GUCA1B n/a
5 TRCN0000056302 GCTGAAGTGGACATTCAAGAT pLKO.1 415 CDS 100% 4.950 3.465 N GUCA1B n/a
6 TRCN0000056300 GATCTATGATAAGGATGGCAA pLKO.1 433 CDS 100% 2.640 1.848 N GUCA1B n/a
7 TRCN0000056298 CTCAACATTGTGGAGGGAATT pLKO.1 479 CDS 100% 0.000 0.000 N GUCA1B n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1183 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1184 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002098.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.