Transcript: Human NM_002203.4

Homo sapiens integrin subunit alpha 2 (ITGA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ITGA2 (3673)
Length:
7843
CDS:
118..3663

Additional Resources:

NCBI RefSeq record:
NM_002203.4
NBCI Gene record:
ITGA2 (3673)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002203.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308078 TGGTGCTCCTCGGGCAAATTA pLKO_005 1479 CDS 100% 15.000 21.000 N ITGA2 n/a
2 TRCN0000308081 ATGGCAATATCACGGTTATTC pLKO_005 1535 CDS 100% 13.200 18.480 N ITGA2 n/a
3 TRCN0000057728 CCGCACAAAGTATTCCCAGAA pLKO.1 1905 CDS 100% 4.050 5.670 N ITGA2 n/a
4 TRCN0000057732 CCTCTCCTGTATGATGCTGAA pLKO.1 2908 CDS 100% 4.050 5.670 N ITGA2 n/a
5 TRCN0000057731 CCGGCCAGATAGTGCTATATA pLKO.1 1502 CDS 100% 15.000 12.000 N ITGA2 n/a
6 TRCN0000289151 CCGGCCAGATAGTGCTATATA pLKO_005 1502 CDS 100% 15.000 12.000 N ITGA2 n/a
7 TRCN0000308080 AGGTAAACTAACCTGGTATTT pLKO_005 3769 3UTR 100% 13.200 9.240 N ITGA2 n/a
8 TRCN0000057730 GCTGGTGACATCAGTTGTAAT pLKO.1 3157 CDS 100% 13.200 9.240 N ITGA2 n/a
9 TRCN0000057729 CGGTCCTTCAAGTGAACAGTT pLKO.1 240 CDS 100% 4.950 3.465 N ITGA2 n/a
10 TRCN0000289152 CGGTCCTTCAAGTGAACAGTT pLKO_005 240 CDS 100% 4.950 3.465 N ITGA2 n/a
11 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 5955 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002203.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.