Transcript: Human NM_002240.5

Homo sapiens potassium inwardly rectifying channel subfamily J member 6 (KCNJ6), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KCNJ6 (3763)
Length:
19659
CDS:
602..1873

Additional Resources:

NCBI RefSeq record:
NM_002240.5
NBCI Gene record:
KCNJ6 (3763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002240.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044410 CGAAGTTGACTACAACAGCTT pLKO.1 1642 CDS 100% 2.640 3.696 N KCNJ6 n/a
2 TRCN0000433866 CAAGGTTTCTGGTGCCTATTT pLKO_005 2238 3UTR 100% 13.200 10.560 N KCNJ6 n/a
3 TRCN0000044411 GTGGAGATTCAACCTATTGAT pLKO.1 865 CDS 100% 5.625 4.500 N KCNJ6 n/a
4 TRCN0000044408 GCTGATCATTAGCCATGAAAT pLKO.1 1429 CDS 100% 13.200 9.240 N KCNJ6 n/a
5 TRCN0000427449 TCAGAGCCAAGTTGATCAAAT pLKO_005 1311 CDS 100% 13.200 9.240 N KCNJ6 n/a
6 TRCN0000044409 GAGGGAATTATTCTTCTCTTA pLKO.1 1097 CDS 100% 4.950 3.465 N KCNJ6 n/a
7 TRCN0000044412 GATGTGGCAAACCTGGAGAAT pLKO.1 1838 CDS 100% 4.950 2.970 N KCNJ6 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 12650 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002240.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06478 pDONR223 100% 99.9% 100% None 495A>G n/a
2 ccsbBroad304_06478 pLX_304 0% 99.9% 100% V5 495A>G n/a
Download CSV