Transcript: Human NM_002249.6

Homo sapiens potassium calcium-activated channel subfamily N member 3 (KCNN3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KCNN3 (3782)
Length:
13034
CDS:
318..2513

Additional Resources:

NCBI RefSeq record:
NM_002249.6
NBCI Gene record:
KCNN3 (3782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002249.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422913 AGACCGAGCTAATTAACTAAC pLKO_005 2625 3UTR 100% 10.800 15.120 N KCNN3 n/a
2 TRCN0000043895 CGTACACAAGTTCAAGCAGTT pLKO.1 2488 CDS 100% 4.050 5.670 N KCNN3 n/a
3 TRCN0000043894 GCTCAATCTCAATGACCACTT pLKO.1 704 CDS 100% 4.050 5.670 N KCNN3 n/a
4 TRCN0000043896 GCAGGACGTAACTAGTAACTT pLKO.1 1778 CDS 100% 0.000 0.000 N KCNN3 n/a
5 TRCN0000426675 AGCGGAGAAGCACGTTCATAA pLKO_005 1967 CDS 100% 13.200 9.240 N KCNN3 n/a
6 TRCN0000043893 CCTTCGGGAAACATGGTTAAT pLKO.1 2042 CDS 100% 13.200 9.240 N KCNN3 n/a
7 TRCN0000043897 TGAGTGACTATGCTCTGATTT pLKO.1 1165 CDS 100% 13.200 9.240 N KCNN3 n/a
8 TRCN0000426986 CATGAGCTCCTGCAAGTATAG pLKO_005 839 CDS 100% 10.800 7.560 N KCNN3 n/a
9 TRCN0000421064 AGAATGTCATGTATGACTTAA pLKO_005 2221 CDS 100% 13.200 7.920 N KCNN3 n/a
10 TRCN0000180546 GCCTGTAATCCCAGGACTTTA pLKO.1 5439 3UTR 100% 13.200 6.600 Y PRR11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002249.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.