Transcript: Human NM_002303.5

Homo sapiens leptin receptor (LEPR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
LEPR (3953)
Length:
4161
CDS:
186..3683

Additional Resources:

NCBI RefSeq record:
NM_002303.5
NBCI Gene record:
LEPR (3953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002303.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430603 TCACATCTGGTGGAGTAATTT pLKO_005 829 CDS 100% 15.000 21.000 N LEPR n/a
2 TRCN0000416710 ATGTCAGTTCAGCCCATAAAT pLKO_005 864 CDS 100% 15.000 10.500 N LEPR n/a
3 TRCN0000058798 CCTGGGCACAAGGACTTAATT pLKO.1 2830 CDS 100% 15.000 10.500 N LEPR n/a
4 TRCN0000058802 GCCTATGAGCAAAGTAAATAT pLKO.1 2384 CDS 100% 15.000 10.500 N LEPR n/a
5 TRCN0000417300 GTGAAACTGATGGGTACTTAA pLKO_005 1492 CDS 100% 13.200 9.240 N LEPR n/a
6 TRCN0000412934 TTATGTGATAACTGCGTTTAA pLKO_005 233 CDS 100% 13.200 9.240 N LEPR n/a
7 TRCN0000058799 CGTGTCTTTACCACACAAGAT pLKO.1 1161 CDS 100% 4.950 3.465 N LEPR n/a
8 TRCN0000058800 GCAAGATAGAAACTGCTCCTT pLKO.1 467 CDS 100% 2.640 1.848 N LEPR n/a
9 TRCN0000058801 CCAGTGTGAAAGCAGAAATTA pLKO.1 1807 CDS 100% 15.000 9.000 N LEPR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002303.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.