Transcript: Human NM_002349.4

Homo sapiens lymphocyte antigen 75 (LY75), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
LY75 (4065)
Length:
6932
CDS:
75..5243

Additional Resources:

NCBI RefSeq record:
NM_002349.4
NBCI Gene record:
LY75 (4065)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002349.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057365 CGGACTGATTTGGTTCCTCTT pLKO.1 5126 CDS 100% 4.050 5.670 N LY75 n/a
2 TRCN0000414629 CCATGTTTATCACCCTAATTA pLKO_005 5413 3UTR 100% 15.000 10.500 N LY75 n/a
3 TRCN0000429726 GTGATTGGTAACTAGGATATG pLKO_005 5521 3UTR 100% 10.800 7.560 N LY75 n/a
4 TRCN0000375342 TGGAAGTTGCTACCAATTTAA pLKO_005 752 CDS 100% 15.000 7.500 Y Ly75 n/a
5 TRCN0000057366 CCACCACCTTAAATTATGAAT pLKO.1 658 CDS 100% 5.625 2.813 Y LY75 n/a
6 TRCN0000057367 GCTGATCTTCACCTAAACTAT pLKO.1 2553 CDS 100% 5.625 2.813 Y LY75 n/a
7 TRCN0000057363 CCCGTCTTACATATTCATCAA pLKO.1 4636 CDS 100% 4.950 2.475 Y LY75 n/a
8 TRCN0000066654 CGTGGCTATGTCTACTGGAAA pLKO.1 1865 CDS 100% 4.950 2.475 Y Ly75 n/a
9 TRCN0000057364 GCCCTAATACTCAACCTCCAA pLKO.1 3255 CDS 100% 2.640 1.320 Y LY75 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6012 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6012 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002349.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.