Transcript: Human NM_002356.7

Homo sapiens myristoylated alanine rich protein kinase C substrate (MARCKS), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MARCKS (4082)
Length:
4296
CDS:
402..1400

Additional Resources:

NCBI RefSeq record:
NM_002356.7
NBCI Gene record:
MARCKS (4082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002356.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029042 TGAAGGTAAACGGCGACGCTT pLKO.1 517 CDS 100% 2.640 3.696 N MARCKS n/a
2 TRCN0000195475 CCCACAGATCCCATCTCAAAT pLKO.1 1580 3UTR 100% 13.200 9.240 N MARCKS n/a
3 TRCN0000362899 TCTACAACCAGGGATTGATTT pLKO_005 1489 3UTR 100% 13.200 9.240 N Marcks n/a
4 TRCN0000194936 CACATGAAGTTTGCAACTTTC pLKO.1 2240 3UTR 100% 10.800 7.560 N MARCKS n/a
5 TRCN0000197145 GAATGGCCACGTGAAGGTAAA pLKO.1 506 CDS 100% 10.800 7.560 N MARCKS n/a
6 TRCN0000029039 CTCCTTCAAGAAGAACAAGAA pLKO.1 908 CDS 100% 4.950 3.465 N MARCKS n/a
7 TRCN0000029041 GAGCGGCTTCTCCTTCAAGAA pLKO.1 899 CDS 100% 4.950 3.465 N MARCKS n/a
8 TRCN0000195043 CTTCAAGAAGTCTTTCAAGCT pLKO.1 878 CDS 100% 2.640 1.848 N MARCKS n/a
9 TRCN0000362910 CTGAGCGGCTTCTCCTTCAAG pLKO_005 897 CDS 100% 1.650 1.155 N Marcks n/a
10 TRCN0000029040 GCCTTCCAAAGCGAACGGACA pLKO.1 482 CDS 100% 0.720 0.504 N MARCKS n/a
11 TRCN0000029043 CAGCCCGAGTGCAGTCCAGAA pLKO.1 1353 CDS 100% 0.000 0.000 N MARCKS n/a
12 TRCN0000199300 CCTCGACTTCTTCGCCCAAGG pLKO.1 793 CDS 100% 0.000 0.000 N MARCKS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002356.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.