Transcript: Human NM_002470.4

Homo sapiens myosin heavy chain 3 (MYH3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MYH3 (4621)
Length:
6032
CDS:
89..5911

Additional Resources:

NCBI RefSeq record:
NM_002470.4
NBCI Gene record:
MYH3 (4621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002470.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160678 CTTACGACTACCCGTTCATTA pLKO.1 1011 CDS 100% 13.200 18.480 N MYH3 n/a
2 TRCN0000164517 CCTTACGACTACCCGTTCATT pLKO.1 1010 CDS 100% 5.625 7.875 N MYH3 n/a
3 TRCN0000159063 GCGTTGTATAATTCCCAATGA pLKO.1 2101 CDS 100% 4.950 6.930 N MYH3 n/a
4 TRCN0000161303 GCTTGCTCAAGAGTCCATATT pLKO.1 3271 CDS 100% 13.200 9.240 N MYH3 n/a
5 TRCN0000162638 CCAGTACAACATTCGCTCATT pLKO.1 2533 CDS 100% 4.950 3.465 N MYH3 n/a
6 TRCN0000158705 GAAGCCTTAGATCAACTTGAA pLKO.1 4559 CDS 100% 4.950 3.465 N MYH3 n/a
7 TRCN0000161581 GAGGATCTGATGGTTGATGTT pLKO.1 4367 CDS 100% 4.950 3.465 N MYH3 n/a
8 TRCN0000161739 CCTAGAGTGAAAGTTGGGAAT pLKO.1 1295 CDS 100% 4.050 2.835 N MYH3 n/a
9 TRCN0000162237 CCTGAATGAAATCGAGATCCA pLKO.1 4954 CDS 100% 2.640 1.848 N MYH3 n/a
10 TRCN0000161331 GCAAGTGAAAGTCAAGTCCTA pLKO.1 5704 CDS 100% 2.640 1.848 N MYH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002470.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.