Transcript: Human NM_002504.6

Homo sapiens nuclear transcription factor, X-box binding 1 (NFX1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NFX1 (4799)
Length:
4599
CDS:
58..3420

Additional Resources:

NCBI RefSeq record:
NM_002504.6
NBCI Gene record:
NFX1 (4799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002504.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257309 GGGTATGGAGCCAGACGAAAT pLKO_005 745 CDS 100% 10.800 15.120 N NFX1 n/a
2 TRCN0000232110 AGGAGCCAATAATTGACTATT pLKO_005 3383 CDS 100% 13.200 9.240 N NFX1 n/a
3 TRCN0000232111 GAATATTCCAAGTAGTATATG pLKO_005 4338 3UTR 100% 13.200 9.240 N NFX1 n/a
4 TRCN0000014903 GCCTCAGTTGTCCCAGTTATT pLKO.1 3775 3UTR 100% 13.200 9.240 N NFX1 n/a
5 TRCN0000232109 ACGGTTGTGTGGACGGCATAA pLKO_005 2130 CDS 100% 10.800 7.560 N NFX1 n/a
6 TRCN0000014907 GCCGTGAATAAGGGAAAGAAT pLKO.1 3085 CDS 100% 5.625 3.938 N NFX1 n/a
7 TRCN0000014905 CCAGTATATCATTCTTGTCAT pLKO.1 2398 CDS 100% 4.950 3.465 N NFX1 n/a
8 TRCN0000014906 GCAGAGAAGATACCCACAGAA pLKO.1 768 CDS 100% 4.950 3.465 N NFX1 n/a
9 TRCN0000232108 GCTGTTCATCAGCATAGTTAT pLKO_005 256 CDS 100% 13.200 7.920 N NFX1 n/a
10 TRCN0000014904 GCAGAAATGAAATTCCACATA pLKO.1 1352 CDS 100% 4.950 2.970 N NFX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002504.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.