Transcript: Human NM_002693.2

Homo sapiens DNA polymerase gamma, catalytic subunit (POLG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
POLG (5428)
Length:
4464
CDS:
283..4002

Additional Resources:

NCBI RefSeq record:
NM_002693.2
NBCI Gene record:
POLG (5428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296644 CAGGGTGAAGCGCTGGATATT pLKO_005 3922 CDS 100% 13.200 18.480 N POLG n/a
2 TRCN0000052993 GCGCTTACTAATGCAGTTTAA pLKO.1 3171 CDS 100% 13.200 18.480 N POLG n/a
3 TRCN0000290536 GCGCTTACTAATGCAGTTTAA pLKO_005 3171 CDS 100% 13.200 18.480 N POLG n/a
4 TRCN0000052996 GCTCACTGACAATAGTGCCAT pLKO.1 2322 CDS 100% 2.640 3.696 N POLG n/a
5 TRCN0000052997 GCAGAGGTGCACAGACTTTAT pLKO.1 1351 CDS 100% 13.200 9.240 N POLG n/a
6 TRCN0000290535 GCAGAGGTGCACAGACTTTAT pLKO_005 1351 CDS 100% 13.200 9.240 N POLG n/a
7 TRCN0000296705 TTCTGGAGGAACGCCCATAAA pLKO_005 2680 CDS 100% 13.200 9.240 N POLG n/a
8 TRCN0000305950 TCTCAGGAGAGAGGTACAAAG pLKO_005 1703 CDS 100% 10.800 7.560 N Polg n/a
9 TRCN0000052995 GCCATGAAGTGGCTGTTTGAA pLKO.1 3625 CDS 100% 5.625 3.938 N POLG n/a
10 TRCN0000052994 CCTGCAAGAATTTAAGCAGAA pLKO.1 1755 CDS 100% 4.050 2.835 N POLG n/a
11 TRCN0000296704 TTCCTTTGACCGAGCTCATAT pLKO_005 1095 CDS 100% 13.200 7.920 N POLG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.