Transcript: Human NM_002779.5

Homo sapiens pleckstrin and Sec7 domain containing (PSD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
PSD (5662)
Length:
3824
CDS:
169..3243

Additional Resources:

NCBI RefSeq record:
NM_002779.5
NBCI Gene record:
PSD (5662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002779.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179015 CAATGTAGTAGCCGCTATGTT pLKO.1 2760 CDS 100% 5.625 7.875 N PSD n/a
2 TRCN0000180367 GCATCAATGTAGTAGCCGCTA pLKO.1 2756 CDS 100% 2.160 3.024 N PSD n/a
3 TRCN0000234811 CCTGGATCACTCGCATCAATG pLKO_005 2744 CDS 100% 10.800 7.560 N PSD n/a
4 TRCN0000238783 GAGAATCGCTAGAGCCAAATG pLKO_005 867 CDS 100% 10.800 7.560 N PSD n/a
5 TRCN0000234810 GGGAGTACCTCAAGTTCTTTG pLKO_005 1943 CDS 100% 10.800 7.560 N PSD n/a
6 TRCN0000238782 GGTTGGAGCAGATGGCCTTTA pLKO_005 714 CDS 100% 10.800 7.560 N PSD n/a
7 TRCN0000234812 GCTTGGACAGAGACCAGGATT pLKO_005 3615 3UTR 100% 4.950 3.465 N PSD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002779.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.