Transcript: Human NM_002936.5

Homo sapiens ribonuclease H1 (RNASEH1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
RNASEH1 (246243)
Length:
5327
CDS:
112..972

Additional Resources:

NCBI RefSeq record:
NM_002936.5
NBCI Gene record:
RNASEH1 (246243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002936.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049785 CCTGGTCATTCGGGATTTATA pLKO.1 895 CDS 100% 15.000 10.500 N RNASEH1 n/a
2 TRCN0000307824 CCTGGTCATTCGGGATTTATA pLKO_005 895 CDS 100% 15.000 10.500 N RNASEH1 n/a
3 TRCN0000303308 ACGATAAATGGTATAACTAAC pLKO_005 751 CDS 100% 10.800 7.560 N RNASEH1 n/a
4 TRCN0000049787 GCTGCCAGATTTAAGAAGTTT pLKO.1 274 CDS 100% 5.625 3.938 N RNASEH1 n/a
5 TRCN0000049783 GCCGTATGCAAAGCACATGAA pLKO.1 447 CDS 100% 4.950 3.465 N RNASEH1 n/a
6 TRCN0000333357 GCCGTATGCAAAGCACATGAA pLKO_005 447 CDS 100% 4.950 3.465 N RNASEH1 n/a
7 TRCN0000049784 GCTGACAGATTAGCCAGAGAA pLKO.1 928 CDS 100% 4.950 3.465 N RNASEH1 n/a
8 TRCN0000049786 GCAAAGCCATTGAACAAGCAA pLKO.1 683 CDS 100% 3.000 2.100 N RNASEH1 n/a
9 TRCN0000291902 GCAAAGCCATTGAACAAGCAA pLKO_005 683 CDS 100% 3.000 2.100 N RNASEH1 n/a
10 TRCN0000331261 TTGTGCCCATGGGTACATTAA pLKO_005 1406 3UTR 100% 13.200 7.920 N RNASEH1 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1741 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1741 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1741 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2864 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4844 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4844 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002936.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.