Transcript: Human NM_002997.5

Homo sapiens syndecan 1 (SDC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
SDC1 (6382)
Length:
3165
CDS:
264..1196

Additional Resources:

NCBI RefSeq record:
NM_002997.5
NBCI Gene record:
SDC1 (6382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002997.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072578 CCGACTGCTTTGGACCTAAAT pLKO.1 1524 3UTR 100% 13.200 18.480 N SDC1 n/a
2 TRCN0000426614 GTTTCTCGCATAGGACCTTTC pLKO_005 1408 3UTR 100% 6.000 8.400 N SDC1 n/a
3 TRCN0000072579 CCGCAAATTGTGGCTACTAAT pLKO.1 327 CDS 100% 13.200 17.160 N SDC1 n/a
4 TRCN0000072582 GCAAGATATCACCTTGTCACA pLKO.1 419 CDS 100% 2.640 2.112 N SDC1 n/a
5 TRCN0000072580 GAGCAGGACTTCACCTTTGAA pLKO.1 885 CDS 100% 5.625 3.938 N SDC1 n/a
6 TRCN0000421256 ACTCGGTTTCTCCAAACTGAA pLKO_005 1463 3UTR 100% 4.950 3.465 N SDC1 n/a
7 TRCN0000414046 ACGCAGCTCCTGACGGCTATT pLKO_005 465 CDS 100% 3.600 2.520 N SDC1 n/a
8 TRCN0000072581 CATGCTGTACCGCATGAAGAA pLKO.1 1082 CDS 100% 0.495 0.297 N SDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002997.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06924 pDONR223 100% 99.7% 99.3% None 407T>A;776G>T n/a
2 ccsbBroad304_06924 pLX_304 0% 99.7% 99.3% V5 407T>A;776G>T n/a
3 TRCN0000471313 CGTATGATAGTATAATGACGGAAT pLX_317 40.7% 99.7% 99.3% V5 407T>A;776G>T n/a
Download CSV