Transcript: Human NM_003028.3

Homo sapiens SH2 domain containing adaptor protein B (SHB), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SHB (6461)
Length:
6035
CDS:
583..2112

Additional Resources:

NCBI RefSeq record:
NM_003028.3
NBCI Gene record:
SHB (6461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149080 GAAATACGTTCTGGGTCAGAA pLKO.1 1974 CDS 100% 4.950 6.930 N SHB n/a
2 TRCN0000275399 GAAATACGTTCTGGGTCAGAA pLKO_005 1974 CDS 100% 4.950 6.930 N SHB n/a
3 TRCN0000275450 CTTGAGTTTCTGTGAATTAAA pLKO_005 2346 3UTR 100% 15.000 10.500 N SHB n/a
4 TRCN0000275452 ATAAAGGTATCCAGTTATATG pLKO_005 1454 CDS 100% 13.200 9.240 N SHB n/a
5 TRCN0000146904 CAGAGGATCATGACAGAATTT pLKO.1 1405 CDS 100% 13.200 9.240 N SHB n/a
6 TRCN0000282026 CAGAGGATCATGACAGAATTT pLKO_005 1405 CDS 100% 13.200 9.240 N SHB n/a
7 TRCN0000149746 GATCCCTTTGATGCCAAGAAT pLKO.1 1324 CDS 100% 5.625 3.938 N SHB n/a
8 TRCN0000148938 CCAAGTGGCTAAACAAGTACT pLKO.1 587 CDS 100% 4.950 3.465 N SHB n/a
9 TRCN0000285376 CCAAGTGGCTAAACAAGTACT pLKO_005 587 CDS 100% 4.950 3.465 N SHB n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3420 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.