Transcript: Human NM_003086.3

Homo sapiens small nuclear RNA activating complex polypeptide 4 (SNAPC4), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SNAPC4 (6621)
Length:
4665
CDS:
10..4419

Additional Resources:

NCBI RefSeq record:
NM_003086.3
NBCI Gene record:
SNAPC4 (6621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017127 GATCGGTATCTCAGGAGATTA pLKO.1 1330 CDS 100% 13.200 18.480 N SNAPC4 n/a
2 TRCN0000234860 GATCGGTATCTCAGGAGATTA pLKO_005 1330 CDS 100% 13.200 18.480 N SNAPC4 n/a
3 TRCN0000234856 GCACTTCATGAAGCCGTATTT pLKO_005 438 CDS 100% 13.200 18.480 N SNAPC4 n/a
4 TRCN0000234859 GGGAGAAGATTTCCAATATTA pLKO_005 797 CDS 100% 15.000 12.000 N SNAPC4 n/a
5 TRCN0000081531 CTGGGAGAAGATTTCCAATAT pLKO.1 795 CDS 100% 13.200 9.240 N Snapc4 n/a
6 TRCN0000234858 GATTGCTTCAGCCCAAGTTAC pLKO_005 617 CDS 100% 10.800 7.560 N SNAPC4 n/a
7 TRCN0000234857 GGAGCTCCTTGTGACCAAATG pLKO_005 540 CDS 100% 10.800 7.560 N SNAPC4 n/a
8 TRCN0000017123 GCTAAGTTGCTTCAAGCTGTT pLKO.1 1237 CDS 100% 4.050 2.835 N SNAPC4 n/a
9 TRCN0000017125 GCTCCTTGTGACCAAATGGAA pLKO.1 543 CDS 100% 3.000 2.100 N SNAPC4 n/a
10 TRCN0000017124 CCAGCCAATATGAACAGGGAA pLKO.1 3418 CDS 100% 2.640 1.848 N SNAPC4 n/a
11 TRCN0000017126 CCGTCTTAAATGTACCGCTCT pLKO.1 2846 CDS 100% 2.160 1.512 N SNAPC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.