Transcript: Human NM_003105.6

Homo sapiens sortilin related receptor 1 (SORL1), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SORL1 (6653)
Length:
10863
CDS:
19..6663

Additional Resources:

NCBI RefSeq record:
NM_003105.6
NBCI Gene record:
SORL1 (6653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003105.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413014 AGTAACAACCGCACCAATTTA pLKO_005 1114 CDS 100% 15.000 21.000 N SORL1 n/a
2 TRCN0000419682 TGGATGATTGCGGCGATTATT pLKO_005 4058 CDS 100% 15.000 21.000 N SORL1 n/a
3 TRCN0000062951 CCTCTGGATCACGTTTGACTT pLKO.1 576 CDS 100% 4.950 6.930 N SORL1 n/a
4 TRCN0000189871 CCTCTGGATCACGTTTGACTT pLKO.1 576 CDS 100% 4.950 6.930 N Sorl1 n/a
5 TRCN0000414418 TGTATCCCACTGTCCTATAAA pLKO_005 3409 CDS 100% 15.000 10.500 N SORL1 n/a
6 TRCN0000062952 CCTATGCCATTGCTGTCTTTA pLKO.1 2906 CDS 100% 13.200 9.240 N SORL1 n/a
7 TRCN0000062948 GCCCAGTTTGTCACAAGACAT pLKO.1 1030 CDS 100% 4.950 3.465 N SORL1 n/a
8 TRCN0000062949 GCTGCTAGTAACTTTACAGAA pLKO.1 5125 CDS 100% 4.950 2.970 N SORL1 n/a
9 TRCN0000062950 CCAGGACTTGTTGTATGCAAT pLKO.1 5898 CDS 100% 4.950 6.930 N SORL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003105.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.