Transcript: Human NM_003128.3

Homo sapiens spectrin beta, non-erythrocytic 1 (SPTBN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SPTBN1 (6711)
Length:
10211
CDS:
240..7334

Additional Resources:

NCBI RefSeq record:
NM_003128.3
NBCI Gene record:
SPTBN1 (6711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116823 GCTGAAATTGATGCACGTAAT pLKO.1 6111 CDS 100% 10.800 15.120 N SPTBN1 n/a
2 TRCN0000290162 GCTGAAATTGATGCACGTAAT pLKO_005 6111 CDS 100% 10.800 15.120 N SPTBN1 n/a
3 TRCN0000116824 GCTAGTATTGTCTCAAGACTA pLKO.1 1886 CDS 100% 4.950 6.930 N SPTBN1 n/a
4 TRCN0000290234 GCTAGTATTGTCTCAAGACTA pLKO_005 1886 CDS 100% 4.950 6.930 N SPTBN1 n/a
5 TRCN0000296592 AGCGGTGCTTAATCAATATTT pLKO_005 7665 3UTR 100% 15.000 10.500 N SPTBN1 n/a
6 TRCN0000091898 GCCAGAAATCTGCACAGTAAA pLKO.1 4155 CDS 100% 13.200 9.240 N Sptbn1 n/a
7 TRCN0000091899 CCTGCATTGAACTTGGGAAAT pLKO.1 6145 CDS 100% 10.800 7.560 N Sptbn1 n/a
8 TRCN0000116822 CCTCGCATTGACGACATCTTT pLKO.1 4854 CDS 100% 5.625 3.938 N SPTBN1 n/a
9 TRCN0000116825 CCCACAATAAGAAAGCCTCAA pLKO.1 6874 CDS 100% 4.050 2.835 N SPTBN1 n/a
10 TRCN0000116826 CCAAGTGAGAAGGAAATCAAA pLKO.1 3000 CDS 100% 5.625 3.375 N SPTBN1 n/a
11 TRCN0000290236 CCAAGTGAGAAGGAAATCAAA pLKO_005 3000 CDS 100% 5.625 3.375 N SPTBN1 n/a
12 TRCN0000091900 CGCTTCCAGATCCAGGATATT pLKO.1 705 CDS 100% 13.200 9.240 N Sptbn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.