Transcript: Human NM_003459.5

Homo sapiens solute carrier family 30 member 3 (SLC30A3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLC30A3 (7781)
Length:
2936
CDS:
142..1308

Additional Resources:

NCBI RefSeq record:
NM_003459.5
NBCI Gene record:
SLC30A3 (7781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003459.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427938 CTACTCCCGGTTTGGATTCTC pLKO_005 1209 CDS 100% 4.950 6.930 N SLC30A3 n/a
2 TRCN0000038348 CGTTTGAAGAGTCTCTTCACA pLKO.1 226 CDS 100% 0.300 0.420 N SLC30A3 n/a
3 TRCN0000038347 CCTTACGCTCACTTACCATGT pLKO.1 1116 CDS 100% 4.050 3.240 N SLC30A3 n/a
4 TRCN0000415522 GTTCGAACCTGTGCGGGATAC pLKO_005 1044 CDS 100% 2.000 1.600 N SLC30A3 n/a
5 TRCN0000423693 CACTTTGTCCGTGTGTCTTAG pLKO_005 1784 3UTR 100% 10.800 7.560 N SLC30A3 n/a
6 TRCN0000038345 CTGTGCCGTTTGCTTTGTCTT pLKO.1 378 CDS 100% 4.950 3.465 N SLC30A3 n/a
7 TRCN0000038346 TCATCTACTTCAAGCCTCAAT pLKO.1 905 CDS 100% 4.950 3.465 N SLC30A3 n/a
8 TRCN0000038344 GCCAACCTGTTAATGGCCTTT pLKO.1 709 CDS 100% 4.050 2.835 N SLC30A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003459.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.