Transcript: Human NM_003664.4

Homo sapiens adaptor related protein complex 3 subunit beta 1 (AP3B1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
AP3B1 (8546)
Length:
4060
CDS:
177..3461

Additional Resources:

NCBI RefSeq record:
NM_003664.4
NBCI Gene record:
AP3B1 (8546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003664.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065059 CCTGCATTTGTACCAACGAAA pLKO.1 2763 CDS 100% 4.950 6.930 N AP3B1 n/a
2 TRCN0000286137 CCTGCATTTGTACCAACGAAA pLKO_005 2763 CDS 100% 4.950 6.930 N AP3B1 n/a
3 TRCN0000065061 CCAGGATAATATACACAGGTT pLKO.1 3290 CDS 100% 2.640 3.696 N AP3B1 n/a
4 TRCN0000293216 AGGACTAGCTGCCCATTATTT pLKO_005 2816 CDS 100% 15.000 10.500 N AP3B1 n/a
5 TRCN0000293164 TGCTAACCAAAGAGCATATAT pLKO_005 3655 3UTR 100% 15.000 10.500 N AP3B1 n/a
6 TRCN0000382354 AGGACCCAAACCAACTAATTC pLKO_005 550 CDS 100% 13.200 9.240 N AP3B1 n/a
7 TRCN0000379652 GAGATCAAGAAGTTGGTATAT pLKO_005 453 CDS 100% 13.200 9.240 N AP3B1 n/a
8 TRCN0000065062 GCAAGTATTCTTTGGCTAATT pLKO.1 1665 CDS 100% 13.200 9.240 N AP3B1 n/a
9 TRCN0000286136 GCAAGTATTCTTTGGCTAATT pLKO_005 1665 CDS 100% 13.200 9.240 N AP3B1 n/a
10 TRCN0000065060 GCAGCCACTATTCAGACTATA pLKO.1 1440 CDS 100% 13.200 9.240 N AP3B1 n/a
11 TRCN0000286138 GCAGCCACTATTCAGACTATA pLKO_005 1440 CDS 100% 13.200 9.240 N AP3B1 n/a
12 TRCN0000100444 GCTGTCCAACAGGGATGAAAT pLKO.1 1523 CDS 100% 13.200 9.240 N Ap3b1 n/a
13 TRCN0000065058 CCTCTCAGCTTGGTATGTGAA pLKO.1 3862 3UTR 100% 4.950 3.465 N AP3B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003664.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.