Transcript: Human NM_003802.3

Homo sapiens myosin heavy chain 13 (MYH13), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MYH13 (8735)
Length:
5994
CDS:
92..5908

Additional Resources:

NCBI RefSeq record:
NM_003802.3
NBCI Gene record:
MYH13 (8735)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244810 TCGGCAGACATCGAAACTTAT pLKO_005 875 CDS 100% 13.200 18.480 N MYH13 n/a
2 TRCN0000179923 CGTCCATTCGATTCCAAGAAA pLKO.1 179 CDS 100% 5.625 7.875 N MYH13 n/a
3 TRCN0000257024 CCGGACGGTAGAAGATCAATT pLKO_005 3850 CDS 100% 13.200 10.560 N MYH13 n/a
4 TRCN0000244809 CCTGCTTTGTAGCGGATAATA pLKO_005 201 CDS 100% 15.000 10.500 N MYH13 n/a
5 TRCN0000244808 AGATAAAGTCAATGGTCTAAT pLKO_005 3145 CDS 100% 13.200 9.240 N MYH13 n/a
6 TRCN0000244811 ATGTCCCAGGAATCCATTATG pLKO_005 3284 CDS 100% 13.200 9.240 N MYH13 n/a
7 TRCN0000147274 GAACTCTTCAAGATGAGGAAT pLKO.1 4541 CDS 100% 4.950 2.970 N MYH13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003802.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.