Transcript: Human NM_003970.4

Homo sapiens myomesin 2 (MYOM2), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
MYOM2 (9172)
Length:
5008
CDS:
136..4533

Additional Resources:

NCBI RefSeq record:
NM_003970.4
NBCI Gene record:
MYOM2 (9172)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003970.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431573 AGCGAGATACACAGAATTAAA pLKO_005 3310 CDS 100% 15.000 21.000 N MYOM2 n/a
2 TRCN0000147401 GCTGATAGTTGATCACACATT pLKO.1 4639 3UTR 100% 4.950 6.930 N MYOM2 n/a
3 TRCN0000416250 CAAGACTGAACAACGTGTATT pLKO_005 4730 3UTR 100% 13.200 9.240 N MYOM2 n/a
4 TRCN0000146727 CTAAGGGAGAAAGCTAATGTT pLKO.1 4704 3UTR 100% 5.625 3.938 N MYOM2 n/a
5 TRCN0000147127 CGAAGTGATTTGGTTCAAGAA pLKO.1 4257 CDS 100% 4.950 3.465 N MYOM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003970.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.