Transcript: Human NM_003982.4

Homo sapiens solute carrier family 7 member 7 (SLC7A7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-19
Taxon:
Homo sapiens (human)
Gene:
SLC7A7 (9056)
Length:
2082
CDS:
159..1694

Additional Resources:

NCBI RefSeq record:
NM_003982.4
NBCI Gene record:
SLC7A7 (9056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003982.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043033 GCAGATCAGATATTTGGAATA pLKO.1 1059 CDS 100% 10.800 7.560 N SLC7A7 n/a
2 TRCN0000043035 CAGAACATAAGCGACCGCTTT pLKO.1 1549 CDS 100% 4.050 2.835 N SLC7A7 n/a
3 TRCN0000043037 CCTTTGGAGGATTCCTTGCTT pLKO.1 487 CDS 100% 3.000 2.100 N SLC7A7 n/a
4 TRCN0000043034 GCTCATATACAGTGCCTCCTT pLKO.1 344 CDS 100% 2.640 1.848 N SLC7A7 n/a
5 TRCN0000043036 GCTGCCTGCATTTGTCTCTTA pLKO.1 645 CDS 100% 4.950 2.970 N SLC7A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003982.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07351 pDONR223 99.4% 99.9% 100% None 1527A>G n/a
2 ccsbBroad304_07351 pLX_304 0% 99.9% 100% V5 (not translated due to prior stop codon) 1527A>G n/a
Download CSV