Transcript: Human NM_004145.4

Homo sapiens myosin IXB (MYO9B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MYO9B (4650)
Length:
7606
CDS:
157..6630

Additional Resources:

NCBI RefSeq record:
NM_004145.4
NBCI Gene record:
MYO9B (4650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004145.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273292 GACCGTCAACGACAAGCTTAT pLKO_005 1533 CDS 100% 10.800 15.120 N MYO9B n/a
2 TRCN0000007139 CCCAAGTACGTGAAGATGTAT pLKO.1 745 CDS 100% 5.625 7.875 N MYO9B n/a
3 TRCN0000273293 CGACTCTAAATCCACGTTTAA pLKO_005 4386 CDS 100% 13.200 10.560 N MYO9B n/a
4 TRCN0000007140 CCTCTCCTATATCTGGCTCAT pLKO.1 5103 CDS 100% 4.050 3.240 N MYO9B n/a
5 TRCN0000025920 CCGCGATTTGCATAACCAAAT pLKO.1 2373 CDS 100% 1.080 0.864 N Myo9b n/a
6 TRCN0000273359 ACGTGGTTTACGTAACTTTAA pLKO_005 6928 3UTR 100% 13.200 9.240 N MYO9B n/a
7 TRCN0000007138 GCCCATTGAGAGCTTGTTTAT pLKO.1 4746 CDS 100% 13.200 9.240 N MYO9B n/a
8 TRCN0000273362 GCCCATTGAGAGCTTGTTTAT pLKO_005 4746 CDS 100% 13.200 9.240 N MYO9B n/a
9 TRCN0000007137 CAGCCTTAATGGAAGACCAAA pLKO.1 6956 3UTR 100% 4.950 3.465 N MYO9B n/a
10 TRCN0000007141 GCACGTCAAGTTCCAGAACAA pLKO.1 3627 CDS 100% 4.950 3.465 N MYO9B n/a
11 TRCN0000273294 GCACGTCAAGTTCCAGAACAA pLKO_005 3627 CDS 100% 4.950 3.465 N MYO9B n/a
12 TRCN0000025943 CCCTTTAAGTTCCTGCCCATT pLKO.1 718 CDS 100% 4.050 2.835 N Myo9b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004145.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.