Transcript: Human NM_004225.3

Homo sapiens malignant fibrous histiocytoma amplified sequence 1 (MFHAS1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MFHAS1 (9258)
Length:
6399
CDS:
573..3731

Additional Resources:

NCBI RefSeq record:
NM_004225.3
NBCI Gene record:
MFHAS1 (9258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073028 CGGTTCATCGTGTATGACTTA pLKO.1 1986 CDS 100% 4.950 6.930 N MFHAS1 n/a
2 TRCN0000291870 CGGTTCATCGTGTATGACTTA pLKO_005 1986 CDS 100% 4.950 6.930 N MFHAS1 n/a
3 TRCN0000331258 TGGGTTTGTGGAAGATCAAAG pLKO_005 1672 CDS 100% 10.800 8.640 N MFHAS1 n/a
4 TRCN0000073031 CCATGCATCATTACCAAATAT pLKO.1 3407 CDS 100% 15.000 10.500 N MFHAS1 n/a
5 TRCN0000073030 GCCATGCATCATTACCAAATA pLKO.1 3406 CDS 100% 13.200 9.240 N MFHAS1 n/a
6 TRCN0000291869 GCCATGCATCATTACCAAATA pLKO_005 3406 CDS 100% 13.200 9.240 N MFHAS1 n/a
7 TRCN0000073032 CTGAGCAGTTGCAGATTGAAT pLKO.1 3202 CDS 100% 5.625 3.938 N MFHAS1 n/a
8 TRCN0000310092 CTGAGCAGTTGCAGATTGAAT pLKO_005 3202 CDS 100% 5.625 3.938 N MFHAS1 n/a
9 TRCN0000073029 CCTCAATAAACCCAAGGGCAA pLKO.1 3068 CDS 100% 2.160 1.512 N MFHAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.