Transcript: Human NM_004269.4

Homo sapiens mediator complex subunit 27 (MED27), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MED27 (9442)
Length:
1385
CDS:
24..959

Additional Resources:

NCBI RefSeq record:
NM_004269.4
NBCI Gene record:
MED27 (9442)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004269.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330486 CTTTCATAAAGCAGCGCCATG pLKO_005 1073 3UTR 100% 2.250 1.575 N MED27 n/a
2 TRCN0000330485 CCACTCTTGAAGAGCAGACTC pLKO_005 1104 3UTR 100% 4.050 2.430 N MED27 n/a
3 TRCN0000022026 CCTGGTTAAGAAGTTACATAA pLKO.1 826 CDS 100% 13.200 6.600 Y MED27 n/a
4 TRCN0000330484 CCTGGTTAAGAAGTTACATAA pLKO_005 826 CDS 100% 13.200 6.600 Y MED27 n/a
5 TRCN0000022025 CCGCTAATCAGATGGGAGTAT pLKO.1 430 CDS 100% 4.950 2.475 Y MED27 n/a
6 TRCN0000022027 CCTGAAATGTCCATCCACTTA pLKO.1 543 CDS 100% 4.950 2.475 Y MED27 n/a
7 TRCN0000330482 CCTGAAATGTCCATCCACTTA pLKO_005 543 CDS 100% 4.950 2.475 Y MED27 n/a
8 TRCN0000022028 CCTCTCTATAGTCAACTCCTT pLKO.1 327 CDS 100% 2.640 1.320 Y MED27 n/a
9 TRCN0000022024 GCCTGTTCATTGATCGAACAA pLKO.1 640 CDS 100% 0.495 0.248 Y MED27 n/a
10 TRCN0000330483 GCCTGTTCATTGATCGAACAA pLKO_005 640 CDS 100% 0.495 0.248 Y MED27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004269.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.