Transcript: Human NM_004291.4

Homo sapiens CART prepropeptide (CARTPT), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CARTPT (9607)
Length:
800
CDS:
20..370

Additional Resources:

NCBI RefSeq record:
NM_004291.4
NBCI Gene record:
CARTPT (9607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004291.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118683 TGATGCTACCTCTGTTGGGTA pLKO.1 72 CDS 100% 2.640 3.696 N CARTPT n/a
2 TRCN0000118682 CAAGAGTAAACGTGTTCCCAT pLKO.1 211 CDS 100% 2.640 2.112 N CARTPT n/a
3 TRCN0000121678 GAAGCTCAAGAGTAAACGTGT pLKO.1 205 CDS 100% 2.640 2.112 N CARTPT n/a
4 TRCN0000371637 TTGATACGTGTGTGAAGTATT pLKO_005 568 3UTR 100% 13.200 9.240 N CARTPT n/a
5 TRCN0000371576 TTGGCTTAAGCAACAGATAAA pLKO_005 445 3UTR 100% 13.200 9.240 N CARTPT n/a
6 TRCN0000118684 CCTTCCTCCTGAAGTGCTTAT pLKO.1 348 CDS 100% 10.800 7.560 N CARTPT n/a
7 TRCN0000118685 CCCATCTATGAGAAGAAGTAT pLKO.1 227 CDS 100% 5.625 3.938 N CARTPT n/a
8 TRCN0000371575 ACGAGAAGGAGCTGATCGAAG pLKO_005 165 CDS 100% 4.050 2.835 N CARTPT n/a
9 TRCN0000118686 CCCGAGGAACCTCCTGCAATT pLKO.1 327 CDS 100% 3.600 2.520 N CARTPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004291.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02210 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02210 pLX_304 0% 100% 100% V5 n/a
Download CSV