Transcript: Human NM_004319.3

Homo sapiens astrotactin 1 (ASTN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ASTN1 (460)
Length:
7138
CDS:
37..3921

Additional Resources:

NCBI RefSeq record:
NM_004319.3
NBCI Gene record:
ASTN1 (460)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189339 CCGCTGTATTTCAGATCGCAA pLKO.1 1881 CDS 100% 2.640 3.696 N ASTN1 n/a
2 TRCN0000187578 GCCATGGCCTTACACAATATT pLKO.1 1560 CDS 100% 15.000 10.500 N ASTN1 n/a
3 TRCN0000186111 CCTCTGAACAACATGATCTTT pLKO.1 4625 3UTR 100% 5.625 3.938 N ASTN1 n/a
4 TRCN0000159395 GCCAATGAGATTCACTACATT pLKO.1 628 CDS 100% 5.625 3.938 N ASTN1 n/a
5 TRCN0000162297 CCGGTATTCAACCTTGAGTTT pLKO.1 6739 3UTR 100% 4.950 3.465 N ASTN1 n/a
6 TRCN0000204318 CGACATCATCTCTGGAGCAAA pLKO.1 3285 CDS 100% 4.950 3.465 N ASTN1 n/a
7 TRCN0000159364 GCCATATTTCTTTAGAGGATT pLKO.1 4144 3UTR 100% 4.950 3.465 N ASTN1 n/a
8 TRCN0000194285 GCAGTAAGAATTTCCGCTGTA pLKO.1 1868 CDS 100% 4.050 2.835 N ASTN1 n/a
9 TRCN0000164955 GCTGATGACTTCATCCTCCTT pLKO.1 1779 CDS 100% 2.640 1.848 N ASTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.