Transcript: Human NM_004341.5

Homo sapiens carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (CAD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CAD (790)
Length:
7286
CDS:
184..6861

Additional Resources:

NCBI RefSeq record:
NM_004341.5
NBCI Gene record:
CAD (790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004341.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045910 CGAATCCAGAAGGAACGATTT pLKO.1 6619 CDS 100% 10.800 15.120 N CAD n/a
2 TRCN0000290106 CGAATCCAGAAGGAACGATTT pLKO_005 6619 CDS 100% 10.800 15.120 N CAD n/a
3 TRCN0000045909 CGTGGATTATTGTGTGGTGAA pLKO.1 2379 CDS 100% 4.050 3.240 N CAD n/a
4 TRCN0000045908 GCTCCGAAAGATGGGATATAA pLKO.1 3066 CDS 100% 15.000 10.500 N CAD n/a
5 TRCN0000290036 GCTCCGAAAGATGGGATATAA pLKO_005 3066 CDS 100% 15.000 10.500 N CAD n/a
6 TRCN0000296480 GGGCAGCACACTTAGATATTC pLKO_005 6931 3UTR 100% 13.200 9.240 N CAD n/a
7 TRCN0000296593 TCGGGCTCTCAGGCAATTAAG pLKO_005 1426 CDS 100% 13.200 9.240 N CAD n/a
8 TRCN0000045912 CCCAGATGAAATGGATGAGTT pLKO.1 372 CDS 100% 4.950 3.465 N CAD n/a
9 TRCN0000290108 CCCAGATGAAATGGATGAGTT pLKO_005 372 CDS 100% 4.950 3.465 N CAD n/a
10 TRCN0000045911 CCTGCTAATTAAAGCTGCAAA pLKO.1 5046 CDS 100% 4.950 3.465 N CAD n/a
11 TRCN0000314155 TCGGGCTCTCAGGCAATTAAA pLKO_005 1426 CDS 100% 15.000 10.500 N Cad n/a
12 TRCN0000089812 CTCTTCCTTTGTCACCAAGAA pLKO.1 4398 CDS 100% 4.950 2.970 N Kif3c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004341.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.