Transcript: Human NM_004352.4

Homo sapiens cerebellin 1 precursor (CBLN1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CBLN1 (869)
Length:
2442
CDS:
374..955

Additional Resources:

NCBI RefSeq record:
NM_004352.4
NBCI Gene record:
CBLN1 (869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004352.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063911 TGATTCAGAACGCAGCACTTT pLKO.1 664 CDS 100% 4.950 6.930 N CBLN1 n/a
2 TRCN0000435596 GAAATTAAGAGGGCGAGAAAG pLKO_005 1021 3UTR 100% 10.800 7.560 N CBLN1 n/a
3 TRCN0000063908 GTGAACATTGGGAACAACTTT pLKO.1 644 CDS 100% 5.625 3.938 N CBLN1 n/a
4 TRCN0000063910 GATGAGTAATCGCACCATGAT pLKO.1 601 CDS 100% 4.950 3.465 N CBLN1 n/a
5 TRCN0000063909 CGCCAGCAACGGAGTCCTAAT pLKO.1 829 CDS 100% 3.600 2.520 N CBLN1 n/a
6 TRCN0000106586 CGAGATGAGTAATCGCACCAT pLKO.1 598 CDS 100% 2.640 1.848 N Cbln1 n/a
7 TRCN0000063912 GTCCTAATCCAAATGGAGAAA pLKO.1 842 CDS 100% 4.950 2.970 N CBLN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004352.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.