Transcript: Human NM_004446.3

Homo sapiens glutamyl-prolyl-tRNA synthetase 1 (EPRS1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
EPRS1 (2058)
Length:
4862
CDS:
118..4656

Additional Resources:

NCBI RefSeq record:
NM_004446.3
NBCI Gene record:
EPRS1 (2058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045650 GCTCCACGATATGTTGCATTA pLKO.1 1627 CDS 100% 10.800 15.120 N EPRS1 n/a
2 TRCN0000293873 GCCAAGTACTACACCTTATTT pLKO_005 4621 CDS 100% 15.000 12.000 N EPRS1 n/a
3 TRCN0000045652 CCAACCCTTTATCGCTGCAAA pLKO.1 1177 CDS 100% 4.950 3.960 N EPRS1 n/a
4 TRCN0000286383 CCAACCCTTTATCGCTGCAAA pLKO_005 1177 CDS 100% 4.950 3.960 N EPRS1 n/a
5 TRCN0000293874 ATGAACCTGTTAGCCCATATA pLKO_005 2168 CDS 100% 13.200 9.240 N EPRS1 n/a
6 TRCN0000045649 GCCTGGCAAGAACAGTTGAAA pLKO.1 514 CDS 100% 5.625 3.938 N EPRS1 n/a
7 TRCN0000286384 GCCTGGCAAGAACAGTTGAAA pLKO_005 514 CDS 100% 5.625 3.938 N EPRS1 n/a
8 TRCN0000045648 GCTAATACAATGGAAGACTTT pLKO.1 4396 CDS 100% 4.950 3.465 N EPRS1 n/a
9 TRCN0000293828 CTCTTCAACTCCTCTCACTTT pLKO_005 4675 3UTR 100% 4.950 2.970 N EPRS1 n/a
10 TRCN0000045651 GCCAAAGGAAAGACCCTTCTA pLKO.1 3068 CDS 100% 4.950 2.970 N EPRS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.