Transcript: Human NM_004564.3

Homo sapiens glutamyl-tRNA amidotransferase subunit B (GATB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GATB (5188)
Length:
2369
CDS:
26..1699

Additional Resources:

NCBI RefSeq record:
NM_004564.3
NBCI Gene record:
GATB (5188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229356 CTGAACGAAACACGCTCATTT pLKO_005 953 CDS 100% 13.200 18.480 N GATB n/a
2 TRCN0000159939 GAGGTGAAATTCTGAACGAAA pLKO.1 942 CDS 100% 4.950 3.960 N GATB n/a
3 TRCN0000103341 CCACATAAACAAGAAGTCCTT pLKO.1 409 CDS 100% 2.640 2.112 N Gatb n/a
4 TRCN0000229355 TGAGAGTGGATGCCAATATAT pLKO_005 798 CDS 100% 15.000 10.500 N GATB n/a
5 TRCN0000229357 ACCCACAGCAAGTGATCAATA pLKO_005 1101 CDS 100% 13.200 9.240 N GATB n/a
6 TRCN0000218515 CAGATTTCCTCCAACTCTAAA pLKO_005 245 CDS 100% 13.200 9.240 N GATB n/a
7 TRCN0000429737 CAGATTTCCTCCAACTCTAAA pLKO_005 245 CDS 100% 13.200 9.240 N Gatb n/a
8 TRCN0000160900 GCTGTGGTAGGTTTGGAAATT pLKO.1 218 CDS 100% 13.200 9.240 N GATB n/a
9 TRCN0000160229 CAGAGGCAAATCAATGAACTT pLKO.1 914 CDS 100% 4.950 3.465 N GATB n/a
10 TRCN0000165388 CCCAAGGGACAACAACAAACA pLKO.1 1719 3UTR 100% 4.950 3.465 N GATB n/a
11 TRCN0000161035 CATCCTCAAGTGGTAATGGAT pLKO.1 1559 CDS 100% 3.000 2.100 N GATB n/a
12 TRCN0000162091 CCAGATTTCCTCCAACTCTAA pLKO.1 244 CDS 100% 4.950 2.970 N GATB n/a
13 TRCN0000164682 CAGTTGAGAGTGGATGCCAAT pLKO.1 794 CDS 100% 4.050 2.430 N GATB n/a
14 TRCN0000161550 GAAGTCCTTGTTTGACAGGAA pLKO.1 421 CDS 100% 2.640 1.584 N GATB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.