Transcript: Human NM_004822.3

Homo sapiens netrin 1 (NTN1), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
NTN1 (9423)
Length:
5986
CDS:
140..1954

Additional Resources:

NCBI RefSeq record:
NM_004822.3
NBCI Gene record:
NTN1 (9423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004822.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061944 GAAGCTGAAGATTAACATGAA pLKO.1 1582 CDS 100% 4.950 6.930 N NTN1 n/a
2 TRCN0000431727 GCATCCCGGACTTTGTCAATG pLKO_005 291 CDS 100% 10.800 7.560 N NTN1 n/a
3 TRCN0000061943 GTGAACATCATCTCCGTGTAT pLKO.1 1682 CDS 100% 4.950 3.465 N NTN1 n/a
4 TRCN0000061945 CATCTACAAGTCCATGGACTA pLKO.1 619 CDS 100% 4.050 2.835 N NTN1 n/a
5 TRCN0000061947 CCCTGCATAAAGATCCCTGTA pLKO.1 1487 CDS 100% 4.050 2.835 N NTN1 n/a
6 TRCN0000432824 GACTGCGATTCCTACTGCAAG pLKO_005 1550 CDS 100% 4.050 2.835 N NTN1 n/a
7 TRCN0000061946 CGCCTTCCTCACCGACCTCAA pLKO.1 454 CDS 100% 0.000 0.000 N NTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004822.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.