Transcript: Human NM_004829.7

Homo sapiens natural cytotoxicity triggering receptor 1 (NCR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
NCR1 (9437)
Length:
1157
CDS:
41..955

Additional Resources:

NCBI RefSeq record:
NM_004829.7
NBCI Gene record:
NCR1 (9437)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004829.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063536 CCATCTGTTGCCAGGGAAATT pLKO.1 177 CDS 100% 13.200 9.240 N NCR1 n/a
2 TRCN0000063537 ACTTGCTGGATCTGGTGGTAA pLKO.1 372 CDS 100% 4.950 3.465 N NCR1 n/a
3 TRCN0000063534 CACTGCAACAAGCATGTTCTT pLKO.1 481 CDS 100% 4.950 3.465 N NCR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004829.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02162 pDONR223 100% 99.4% 99.3% None 244C>A;553A>C;682_684delGCA n/a
2 ccsbBroad304_02162 pLX_304 0% 99.4% 99.3% V5 244C>A;553A>C;682_684delGCA n/a
Download CSV