Transcript: Human NM_004946.3

Homo sapiens dedicator of cytokinesis 2 (DOCK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-14
Taxon:
Homo sapiens (human)
Gene:
DOCK2 (1794)
Length:
6069
CDS:
53..5545

Additional Resources:

NCBI RefSeq record:
NM_004946.3
NBCI Gene record:
DOCK2 (1794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040189 CCCAACAAGCAAACGGTCATA pLKO.1 791 CDS 100% 4.950 6.930 N DOCK2 n/a
2 TRCN0000040190 CGCTCCGTTGTGTACTATCAA pLKO.1 1481 CDS 100% 5.625 3.938 N DOCK2 n/a
3 TRCN0000010479 CAAGGAAGTGACAGTTGAGAA pLKO.1 250 CDS 100% 4.950 3.465 N DOCK2 n/a
4 TRCN0000040191 CCAGCACTACTCCTTCTACAT pLKO.1 2899 CDS 100% 4.950 3.465 N DOCK2 n/a
5 TRCN0000091244 CCTATATTAGAGATGACACTT pLKO.1 3323 CDS 100% 4.950 3.465 N Dock2 n/a
6 TRCN0000040192 CCTGGAATTAGCATCACCCAA pLKO.1 5053 CDS 100% 2.640 1.848 N DOCK2 n/a
7 TRCN0000009879 GAACTCAAGGTACCAGCAAGA pLKO.1 5775 3UTR 100% 0.000 0.000 N DOCK2 n/a
8 TRCN0000010480 CATACAGACAGATGTCCATCA pLKO.1 4968 CDS 100% 4.050 2.430 N DOCK2 n/a
9 TRCN0000040188 CCAGTTTCTTAGGTGTAAGAA pLKO.1 5848 3UTR 100% 0.563 0.338 N DOCK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004946.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.