Transcript: Human NM_004975.4

Homo sapiens potassium voltage-gated channel subfamily B member 1 (KCNB1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
KCNB1 (3745)
Length:
11871
CDS:
189..2765

Additional Resources:

NCBI RefSeq record:
NM_004975.4
NBCI Gene record:
KCNB1 (3745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004975.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044784 GCCAAGATCCTTGCCATAATT pLKO.1 750 CDS 100% 15.000 21.000 N KCNB1 n/a
2 TRCN0000424989 GTCATTGACATGCGAAGTATG pLKO_005 1923 CDS 100% 10.800 15.120 N KCNB1 n/a
3 TRCN0000044787 CCCTAAGTTCTTAAGGCAGAA pLKO.1 2603 CDS 100% 4.050 5.670 N KCNB1 n/a
4 TRCN0000044786 CCTGAGAAACACACAGCAATA pLKO.1 2400 CDS 100% 10.800 7.560 N KCNB1 n/a
5 TRCN0000446041 GGAAGGCGAGGAGTTCGATAA pLKO_005 662 CDS 100% 10.800 7.560 N KCNB1 n/a
6 TRCN0000044785 CCCACTCAATGCCATTGACTT pLKO.1 968 CDS 100% 4.950 3.465 N KCNB1 n/a
7 TRCN0000044783 CCGAGCACTTAAAGTCAACTT pLKO.1 2195 CDS 100% 4.950 3.465 N KCNB1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 11687 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 11691 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004975.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.