Transcript: Human NM_004994.3

Homo sapiens matrix metallopeptidase 9 (MMP9), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MMP9 (4318)
Length:
2336
CDS:
20..2143

Additional Resources:

NCBI RefSeq record:
NM_004994.3
NBCI Gene record:
MMP9 (4318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373008 CATTCAGGGAGACGCCCATTT pLKO_005 610 CDS 100% 10.800 15.120 N MMP9 n/a
2 TRCN0000373007 GATGCGTGGAGAGTCGAAATC pLKO_005 196 CDS 100% 10.800 15.120 N MMP9 n/a
3 TRCN0000373061 GCCGGATACAAACTGGTATTC pLKO_005 2214 3UTR 100% 10.800 15.120 N MMP9 n/a
4 TRCN0000373054 TGCATAAGGACGACGTGAATG pLKO_005 1311 CDS 100% 10.800 15.120 N MMP9 n/a
5 TRCN0000051440 CAGTACCGAGAGAAAGCCTAT pLKO.1 2015 CDS 100% 4.050 5.670 N MMP9 n/a
6 TRCN0000051438 CCACAACATCACCTATTGGAT pLKO.1 373 CDS 100% 3.000 4.200 N MMP9 n/a
7 TRCN0000051439 GCGGTGATTGACGACGCCTTT pLKO.1 422 CDS 100% 1.350 1.890 N MMP9 n/a
8 TRCN0000051441 CAGTTTCCATTCATCTTCCAA pLKO.1 884 CDS 100% 3.000 2.100 N MMP9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06591 pDONR223 100% 99.9% 99.7% None 836A>G;1721G>C n/a
2 ccsbBroad304_06591 pLX_304 0% 99.9% 99.7% V5 836A>G;1721G>C n/a
Download CSV