Transcript: Human NM_004998.4

Homo sapiens myosin IE (MYO1E), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MYO1E (4643)
Length:
8644
CDS:
372..3698

Additional Resources:

NCBI RefSeq record:
NM_004998.4
NBCI Gene record:
MYO1E (4643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004998.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153822 CCCGGAAGAAATACGTTCAAA pLKO.1 2503 CDS 100% 5.625 7.875 N MYO1E n/a
2 TRCN0000158158 CGCCATGAATGTGATTGGGAT pLKO.1 1151 CDS 100% 2.640 3.696 N MYO1E n/a
3 TRCN0000152421 CAGAAGCAACTACCTCTGAAA pLKO.1 2967 CDS 100% 4.950 3.465 N MYO1E n/a
4 TRCN0000338525 CAGAAGCAACTACCTCTGAAA pLKO_005 2967 CDS 100% 4.950 3.465 N MYO1E n/a
5 TRCN0000150354 CAGCTTTAATGCCAATGACAT pLKO.1 3581 CDS 100% 4.950 3.465 N MYO1E n/a
6 TRCN0000150353 CCTCATAGAGAACAAAGTGAA pLKO.1 1715 CDS 100% 4.950 3.465 N MYO1E n/a
7 TRCN0000338455 CCTCATAGAGAACAAAGTGAA pLKO_005 1715 CDS 100% 4.950 3.465 N MYO1E n/a
8 TRCN0000151296 GAAGAGATACATGGATGACTA pLKO.1 491 CDS 100% 4.950 3.465 N MYO1E n/a
9 TRCN0000338523 GAAGAGATACATGGATGACTA pLKO_005 491 CDS 100% 4.950 3.465 N MYO1E n/a
10 TRCN0000152890 GCGTCATTATCAGTGGTGAAA pLKO.1 691 CDS 100% 4.950 3.465 N MYO1E n/a
11 TRCN0000338454 GCGTCATTATCAGTGGTGAAA pLKO_005 691 CDS 100% 4.950 3.465 N MYO1E n/a
12 TRCN0000156378 CCTGCATATCTGCTAGGGATA pLKO.1 1293 CDS 100% 4.050 2.835 N MYO1E n/a
13 TRCN0000153955 CGGGTCTTTGATTTCTTGGTA pLKO.1 1455 CDS 100% 3.000 2.100 N MYO1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004998.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14706 pDONR223 89% 99.6% 20% None (many diffs) n/a
Download CSV