Transcript: Human NM_005029.4

Homo sapiens paired like homeodomain 3 (PITX3), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
PITX3 (5309)
Length:
1426
CDS:
193..1101

Additional Resources:

NCBI RefSeq record:
NM_005029.4
NBCI Gene record:
PITX3 (5309)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005029.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434028 GCCTTCAACTCGGTCAACGTG pLKO_005 709 CDS 100% 0.880 1.232 N PITX3 n/a
2 TRCN0000020501 CCGTGCCAGTACGCCGTGGAA pLKO.1 1069 CDS 100% 0.000 0.000 N PITX3 n/a
3 TRCN0000020503 CCTACGTCTATCGGGACCCGT pLKO.1 950 CDS 100% 0.000 0.000 N PITX3 n/a
4 TRCN0000415998 AGGAGCACAGCGACTCAGAAA pLKO_005 299 CDS 100% 4.950 3.465 N PITX3 n/a
5 TRCN0000020500 CCTTTCCATTCGCCTTCAACT pLKO.1 698 CDS 100% 4.950 3.465 N PITX3 n/a
6 TRCN0000020502 CCAGAGGACGGTTCGCTGAAA pLKO.1 349 CDS 100% 1.650 1.155 N PITX3 n/a
7 TRCN0000422472 AGCCAAACAGCACGCCTCCTT pLKO_005 1002 CDS 100% 0.880 0.616 N PITX3 n/a
8 TRCN0000020499 ACCGGCTCAGGAGAGGGCCTT pLKO.1 1229 3UTR 100% 0.000 0.000 N PITX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005029.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.