Transcript: Human NM_005068.2

Homo sapiens SIM bHLH transcription factor 1 (SIM1), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SIM1 (6492)
Length:
3995
CDS:
208..2508

Additional Resources:

NCBI RefSeq record:
NM_005068.2
NBCI Gene record:
SIM1 (6492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416133 GTATCGTCAGCGTCAACTATG pLKO_005 1178 CDS 100% 10.800 15.120 N SIM1 n/a
2 TRCN0000413175 TTGGCTCTCACCGGCAGTATT pLKO_005 2303 CDS 100% 13.200 10.560 N SIM1 n/a
3 TRCN0000015070 GCTTACACATTAACTGGATAT pLKO.1 2335 CDS 100% 10.800 8.640 N SIM1 n/a
4 TRCN0000015069 CCGCACTATCTCGGATAAGTA pLKO.1 2165 CDS 100% 5.625 3.938 N SIM1 n/a
5 TRCN0000015071 CCTCACAGACACAGAATACAA pLKO.1 1200 CDS 100% 5.625 3.938 N SIM1 n/a
6 TRCN0000015068 CCACAGATTGTTAGAGAGTAT pLKO.1 2590 3UTR 100% 4.950 3.465 N SIM1 n/a
7 TRCN0000015072 ACTGGCTAAATTACTGCCTTT pLKO.1 273 CDS 100% 4.050 2.835 N SIM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.