Transcript: Human NM_005113.4

Homo sapiens golgin A5 (GOLGA5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GOLGA5 (9950)
Length:
2879
CDS:
183..2378

Additional Resources:

NCBI RefSeq record:
NM_005113.4
NBCI Gene record:
GOLGA5 (9950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005113.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233056 GAGTTTAGTGGTCCTAATATA pLKO_005 2609 3UTR 100% 15.000 21.000 N GOLGA5 n/a
2 TRCN0000233054 GAGTTTGCTGCACGCCTTAAT pLKO_005 1302 CDS 100% 13.200 18.480 N GOLGA5 n/a
3 TRCN0000118880 CGCCTCTGGAAGTAGTAGTAA pLKO.1 2066 CDS 100% 5.625 7.875 N GOLGA5 n/a
4 TRCN0000118881 CACGCCTTAATAAAGTGGAAA pLKO.1 1312 CDS 100% 4.950 6.930 N GOLGA5 n/a
5 TRCN0000233053 GACCTAAATCTACGTATATTT pLKO_005 352 CDS 100% 15.000 12.000 N GOLGA5 n/a
6 TRCN0000233055 AGTAATGGGTCTTCGATTAAT pLKO_005 2082 CDS 100% 15.000 10.500 N GOLGA5 n/a
7 TRCN0000118877 GCTCTGCTTTATCTGAGTTTA pLKO.1 2595 3UTR 100% 13.200 9.240 N GOLGA5 n/a
8 TRCN0000118879 CCATTCAAAGAGTGATCGAAT pLKO.1 998 CDS 100% 4.950 3.465 N GOLGA5 n/a
9 TRCN0000118878 GCCAGATACATCAGCTCAGAT pLKO.1 1642 CDS 100% 4.950 3.465 N GOLGA5 n/a
10 TRCN0000238792 CTAGTTCAATTGATCAGTTTA pLKO_005 2212 CDS 100% 0.000 0.000 N GOLGA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005113.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.