Transcript: Human NM_005131.3

Homo sapiens THO complex 1 (THOC1), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
THOC1 (9984)
Length:
2108
CDS:
29..2002

Additional Resources:

NCBI RefSeq record:
NM_005131.3
NBCI Gene record:
THOC1 (9984)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272560 GGGAGTAACTGAAGGTATTTG pLKO_005 271 CDS 100% 13.200 18.480 N THOC1 n/a
2 TRCN0000272632 GTGCTCTATTCCAATTGATTA pLKO_005 703 CDS 100% 13.200 18.480 N THOC1 n/a
3 TRCN0000272561 CAAAGATGGTAGAGCATATAT pLKO_005 1152 CDS 100% 15.000 10.500 N THOC1 n/a
4 TRCN0000000033 AGATACCAAACCTACGAGAAT pLKO.1 1243 CDS 100% 4.950 3.465 N THOC1 n/a
5 TRCN0000000032 GTATGTGCAATGATCTCCTAA pLKO.1 441 CDS 100% 4.950 3.465 N THOC1 n/a
6 TRCN0000000029 TGATAAGAGGTCCACTGGTTT pLKO.1 2060 3UTR 100% 4.950 3.465 N THOC1 n/a
7 TRCN0000272617 TGATAAGAGGTCCACTGGTTT pLKO_005 2060 3UTR 100% 4.950 3.465 N THOC1 n/a
8 TRCN0000000031 AGACTCAGAAATTAGGCAGAT pLKO.1 1813 CDS 100% 4.050 2.835 N THOC1 n/a
9 TRCN0000272558 AGACTCAGAAATTAGGCAGAT pLKO_005 1813 CDS 100% 4.050 2.835 N THOC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07525 pDONR223 100% 99.9% 100% None 657C>T n/a
2 ccsbBroad304_07525 pLX_304 0% 99.9% 100% V5 657C>T n/a
3 TRCN0000470869 TTTATGCTAAAACAACGGGCGGCC pLX_317 10.6% 99.9% 100% V5 657C>T n/a
Download CSV